Wednesday, September 19, 2012

Genes that define the shape of our face

Five gene loci appear to define the morphologic shape of a human face. According to Liu et al. in PLOS Genetics 2012|8|9|e1002932, they are located in and around the PRDM16 gene on chromosome 1, the chromosome 2 gene PAX3, TP63 on chromosome 3, C5orf50 on chromosome 5, and the COL17A1 gene on chromosome 10. These findings came from a genome-wide association study (GWAS) performed by members of the International Visible Trait Genetics, or VisiGen, Consortium where several Affymetrix and/or Illumina arrays were used to identify these loci. 

Facial features, in this case were studied in close to 10,000 volunteering Europeans, range from nose width and height to the distance between a person's eyes. The Consortium studied volunteers of European ancestry living in the Netherlands, Australia, Germany, Canada, and the United Kingdom. The group used 3D MRI based phenotyping together with autosomal single-nucleotide-polymorphism (SNP) analysis to extract facial landmarks and to find association for the 48 identified facial phenotypes. They were able to identify common DNA variants within the five genetic loci which led the researchers to conclude that these genes are associated with normal facial shape phenotypes in individuals of European ancestry. 

We can notice differences in facial shape in other individuals when we go out for dinner, look around in a bar, attend social meetings or walk around in a park or the streets of a city. Variations of facial shapes are one of the most noticeable phenotype in humans. Clearly the facial morphology in humans is under genetic regulation. For example, monozygotic twins look more alike than dizygotic twins or other siblings or even unrelated individuals. This indicates that human facial morphology has a strong genetic component. This study identified the genes that are essential for the development of the craniofacial morphology in humans and provided novel links between common DNA variants and normal variation in human facial morphology and confirmed known ones as well. However, more genes that participate in the regulation of these five genes may need to be identified to allow for the prediction of a facial shape from DNA data to be useful for future forensic applications. Already scientists are able to predict certain eye and hair colors with high accuracies using DNA analysis. Table 1 shows the identified genes, their chromosome location as well as the SNPs of the identified genes.
Table 1:  The five identified genes are listed as well as the sequences of the SNPs involved.
Gene
Chromosome
SNP
Sequence
PRDM16
1p36.23-p33
TCTGTGGGGCCCTTTGCAACCTCCCT[C/T]ATGCATGAGCAATTCAGGGGTTTGA

PAX3
2q35
ACAAATTTTAAAAATTAATTTAAAAA[C/T]TCTGTTCTGTTTAACACTAATAATC
TP63
3q28
rs17447439
CCAGGTGCTCATTTGATGATAGCAGC[A/G]TGAAGCTCTTCCCATTCTGCACCGT

C5orf50
5q35.1
TCCAATCCTCTCATCTGTCCCTCTAA[C/T]GGGCTCCGACAGATCACTCCACAGT
COL17A1
10q24.3
CATACCTTTGGGTCCTGGTGGTCCCA[C/T]TGGTCCTTTGTCACCTAAAAAGGAA
Source:  Liu et al., PLOS September 2012; NCBI SNP Database:  http://www.ncbi.nlm.nih.gov/snp?term=rs805722
 
Figure 1: Nature and location of a single-nucleotide polymorphism (SNP). (Left) The chromosomal location of the gene PRDM16 in chromosome 1p36.23-p33 and the info for SNP rs4648379 for humans (Homo sapiens) is illustrated. (Right) The nature of a SNP (pronounced snip) within a DNA sequence is illustrated as well. A SNP is a variation that occurs when a single nucleotide  - A, T, C or G - in the genome differs between members of a biological species or paired chromosomes in an individual (Source: NCBI and Wikipedia).
The following shows the location of a SNP within a gene. The sequence highlighted in grey depicts the sequence of the SNP probe.
>gnl|dbSNP|rs4648379|allelePos=501|totalLen=1001|taxid=9606|snpclass=1|alleles='C/T'|mol=Genomic|build=137
 TTGCCTTTAA GTCTTTGGAC ATATTTATAA GGTATTTTTA AATCTGCTGA TTCTAACATC
 TGGCTCATAT CAGAGTTGGT TTGGATTGGC TGTGGTTTTT TCTAGGCTAT GGGTGACAAT
 TTCCTGTTTC TGTGCACATT TAGTAATTTT TTATTGTATT GGATGTTGTA GATGACATTG
 TAGAAACTCT GGATTCTGTT GTATTCCTCT GAAAAGTTTT GGTTTTGGTT CTAGAGAGAG
 TTTCAATCAC TAGGTGCTCA CCCTGAGTTT GCAGAAGTGT GGCTCTACAC TTTATTAGGT
 TGGGTCTTCT TCTGTTTTAT CTTTAGGATT AGTCTTTGTT CTTAAGGCTC AGCCCTTCTG
 GGACTTTAGT GGAAAGCCAA AGGTGATCAT CAAGCTCTTC TAAGTTGATG GGACTCAAAT
 TCCAAAGCCC TGCTGTGGTA AGCAGCAAGT GAAATCTCTG TGTAGCTCTT GTTTTCTGTG
 GGGCCCTTTG CAACCTCCCT
 Y
 ATGCATGAGC AATTCAGGGG TTTGAGGGGT GTATATGCAC ACAGGAGGAT CATGTCTCTG
 TGGCTCCTTC CTTTCCATGG TTTCTCCCCT CAACTTACAG ATGCTCTGAC AGCCTCACAC
 TGCATCCTCT GACCCATCTG TCCCATAAGA CTGCAGCTTT CTGCCCGAGT TCCAGCTGCC
 CTGTACCAAG TAGGCTGCAC AGTGGCCTTG AGGGAATACC TGGAGGACAG TGGCCCTCAC
 AGTGCACTGC TTTCCTTCAA GGGTTCAGTT CCTCCAGTTC CCACCTGCTT TTTGTTATTC
 TCTAGTGCTA TCAAGTTTTT TTTGTTTTAA ATTATTTTTT TCCAAGTGTA TCATTGTTAT
 CTGCAGGAGA GTACATCCAA CAGAAGCTAC TCTACCACTG TGGGAACCGG AGGCTCCTGG
 GCCCCACTCT TTATTATGCC ACATGCACAT CCATTTTAAG CCAACAGCCA CACGCACCTC
 CACTGTGAGT TCTGTGGCCT

What are genome-wide association studies?

A genome-wide association study is a relatively new technique allowing scientists to identify genes involved in human disease or genetic traits. The genome is searched for small variations, called SNPs that occur more frequently in people with a particular disease or trait than in people without the disease or the trait. Each study may look at hundreds or thousands of SNPs at the same time. The resulting data is used to pinpoint genes that may contribute to a person’s risk of developing a certain disease or the type of hair color.
For more information about genome-wide association studies see: The National Human Genome Research Institute provides more information at:  http://www.genome.gov/20019523.
For more information on Amino acid analysis, Oligo Synthesis, Peptide, Please Visit : Long RNA

13 comments:

bio syn said...

Specialize in amino acid analysis, oligo synthesis and peptide synthesis

reginag said...

Truly a great advice. Thanks for this useful info.

gray hair treatment

Jason Chang said...

After reading your post I really feel glad, I've been doing a research on the subject and your blog just cleared up a lot of questions.

Peptide Synthesizers

Zubair Gexton said...

thanks this is good blog.
research liquids

Greg James said...

I was pinning away for such type of blogs, thanks for posting this for us.
http://purchasepeptides.com/

Greg James said...

I was pinning away for such type of blogs, thanks for posting this for us.
buy peptides

Alex cyril said...

Your blog is awesome and really helpfull for readers. If you require Custom peptide synthesis to visit here.

David Ricardo said...

The information that you provided was helpful for readers. I will have to share your article with others.

Thanks and best regard
custom gene synthesis

Brown Ada said...

Thus, will it be possible to change the face look by modifying the related genes?

-BOC Sciences inhibitor

raju ahmad said...

wow this is a high knowledge about human DNA, for me i dont understand but i like it, thanks, DNA manusia di ruang angkasa

Zulkifli Yusuf said...

brother printer driver software
aneh dan gokil
happiness in life
duel yamaha ducati

MAC multiple OS
cancer stories
diabetes stories
smartphone review
cam tips
business fact
easy food recipes
mainkan game sekarang
politic opinion
super computer
game tricks

raju ahmad said...

noice info, thanks bro

Download router firmware

raju ahmad said...

thanks again bro

visit:

PC game analysis
HP driver download
natural herbal